touch the grass anon

just for fun i wrote some code that encode and decodes messages in this format, which a non-computer-science person claimed to have received by aliens while they were sleeping

what's interesting about this code: it's not binary, its quaternary. its composed of 4 different symbols in a way that lets you encode 3 different messages simultaneously, its a kind of multiplexed code.

already that was kind of curious to me. if someone did make this up its pretty clever and I've never seen this type of steganography before:

■┃│□│□□┃■┃│■┃│□┃■│┃■┃│□│□┃│■┃□□│□│┃□┃┃│■□┃┃□□│□┃■│┃■┃│┃□■┃││□┃□■■■┃■□■□□■┃┃│□┃□■■││■┃■□■■┃┃│■■│■■┃□■■│■│□┃┃■□■□│■┃│┃■┃□□■□│■□■■■□┃┃┃■□┃┃■┃│□││┃│■┃┃□┃││┃■│┃■┃┃┃□■■│□■□■□■│┃│■┃■┃□│┃│■■□■■││■┃┃││■┃┃□│┃┃■■■┃□■□■□■┃┃□■┃■│□││■■■□┃■││┃■■┃■■││┃■┃□□□│┃■│□□□■┃││□□│┃■■┃■■□■□□││□┃│■■□││■■┃□┃□││■□□□┃■││■□┃□■□┃│■

another interesting thing about 4-symbol codes is that it can be encoded as DNA:

ATGCGCCTATGATGCTAGTATGCGCTGATCCGCGTCTTGACTTCCGCTAGTATGTCATGGCTCAAATACACCATTGCTCAAGGATACAATTGAAGAATCAAGAGCTTACACGATGTATCCACGACAAACTTTACTTATGCGGTGATTCTGGTAGTATTTCAAGCACACAGTGATATCGTGAACAAGGATTGGATTCGTTAAATCACACATTCATAGCGGAAACTAGGTAATAAGGTATCCCGTAGCCCATGGCCGTAATAACACCGGCTGAACGGAATCTCGGACCCTAGGACTCACTGA

DNA has been theorized as a very efficient way to store information at very small scales.

the multiplexed message decodes to:

> imminent thrEat soon upon earths lead

> royal EMERTHER warn

> eMbRace this vess

this is probably a hoax, but reverse engineering the encoding was pretty fun.

At the risk of sounding like a basic white girl. It’s best to not respond to or elevate negative emotions or energy within yourself.

I posted two notes with embedded nuts yesterday and both of those nuts are still available. I am disappointed.