Avatar
satsMiner
f1808f412e91524a6b1337919f59b40796bea9c1d5b57bde3692c6fa4b842161
BUIDL, one block at a time. TRADEL, one coin at the time. https://x.com/satsMiner

Welcome to #nostr. The bar is censorship free. Fire exits on left and all important people are right here. Enjoy!

Replying to Avatar jb55

just for fun i wrote some code that encode and decodes messages in this format, which a non-computer-science person claimed to have received by aliens while they were sleeping

what's interesting about this code: it's not binary, its quaternary. its composed of 4 different symbols in a way that lets you encode 3 different messages simultaneously, its a kind of multiplexed code.

already that was kind of curious to me. if someone did make this up its pretty clever and I've never seen this type of steganography before:

■┃│░│░░┃■┃│■┃│░┃■│┃■┃│░│░┃│■┃░░│░│┃░┃┃│■░┃┃░░│░┃■│┃■┃│┃░■┃││░┃░■■■┃■░■░░■┃┃│░┃░■■││■┃■░■■┃┃│■■│■■┃░■■│■│░┃┃■░■░│■┃│┃■┃░░■░│■░■■■░┃┃┃■░┃┃■┃│░││┃│■┃┃░┃││┃■│┃■┃┃┃░■■│░■░■░■│┃│■┃■┃░│┃│■■░■■││■┃┃││■┃┃░│┃┃■■■┃░■░■░■┃┃░■┃■│░││■■■░┃■││┃■■┃■■││┃■┃░░░│┃■│░░░■┃││░░│┃■■┃■■░■░░││░┃│■■░││■■┃░┃░││■░░░┃■││■░┃░■░┃│■

another interesting thing about 4-symbol codes is that it can be encoded as DNA:

ATGCGCCTATGATGCTAGTATGCGCTGATCCGCGTCTTGACTTCCGCTAGTATGTCATGGCTCAAATACACCATTGCTCAAGGATACAATTGAAGAATCAAGAGCTTACACGATGTATCCACGACAAACTTTACTTATGCGGTGATTCTGGTAGTATTTCAAGCACACAGTGATATCGTGAACAAGGATTGGATTCGTTAAATCACACATTCATAGCGGAAACTAGGTAATAAGGTATCCCGTAGCCCATGGCCGTAATAACACCGGCTGAACGGAATCTCGGACCCTAGGACTCACTGA

DNA has been theorized as a very efficient way to store information at very small scales.

the multiplexed message decodes to:

> imminent thrEat soon upon earths lead

> royal EMERTHER warn

> eMbRace this vess

this is probably a hoax, but reverse engineering the encoding was pretty fun.

Those 12 words could be seeds from DNAliens. Or we could have private keys in quarternary codes. πŸ€” your DNA is your private code biologically.

Hi friends. I hope everybody enjoyed Black Friday season and has loaded with more sats at $80k levels. I too wish I would buy more bitcoin.

I am still surprised when anybody asks me which #crypto they should buy.

But in fact, there is only #Bitcoin, and everything else is a scam. We must get better at explaining this to everybody. This should be clear to everyone, so that we can move on.

The digital dollar is America’s new superpower and China knows it. Dollar-backed stablecoins slip past Beijing’s capital controls, spreading U.S. influence through code, not armies.

Every digital dollar is lost ground for the renminbi.

If money can be printed, they will be printed.

If supply is uncapped, then you have unlimited supply.

#21milion #BTC

Everything is noise now:

AI fakes voice and images

Media fake news

Social nets fake likes, followers

Governments fake statistics and money

Algorithms fake your feed and your opinions

Even friends fake being friends

Cryptos fake Bitcoin

The only signal left is #bitcoin

Bought some more #btc this dip at $108k. Please resume up trend.

The name β€œ[Sovereign Engineering](https://sovereignengineering.io/)” was not chosen by accident. It is our essence, our story, our rallying cry for a better future, a better internet. It is our mission statement. When we chose it, we were very deliberate. It’s a declaration of intent. It’s the banner under which we sail.

### Engineering Sovereignty

First and foremost, this is a program for *engineers*. Not researchers, not theorists, not thinkers, not talkers. Engineers. People who build things. People who *ship* things.

In a world drowning in bullshit, the ability to build and ship is a superpower. It cuts through the noise. It’s a practical, tangible, and undeniable proof of work. An idea is worth little. A working prototype is worth a thousand brainstorm sessions. A shipped product is worth a thousand prototypes.

This is why we focus on engineering as a *craft*. A discipline. It’s not just about slapping some code together. It’s about understanding the materials, the tools, and the trade-offs. It’s about building things that are robust, reliable, and resilient. Things that are *seaworthy*.

### In the Spirit of Bitcoin

What does it mean to build something "in the spirit of Bitcoin?" It’s a question we return to again and again. It’s a philosophical touchstone, a guiding principle. It's about building things *right*.

Bitcoin is more than just code; it's a set of values made manifest. It’s about decentralization, censorship-resistance, and individual empowerment. It’s about creating systems that are transparent, auditable, and antifragile.

Building in the spirit of Bitcoin means embracing these values. It means favoring simplicity over complexity. It means building for the long term, not for a quick flip. It means creating tools that serve the user, not the other way around. It’s a commitment to open-source, to permissionless innovation, and to the idea that technology should be a liberating force.

This [philosophy](https://sovereignengineering.io/philosophy) is downstream from our worldview. It informs not just *what* we build, but *how* we build it, and *why*. It’s a rejection of the parasitic models of the current web, the walled gardens, the data silos, the [attention economy](https://njump.me/nevent1qqsqm2lz4ru6wlydzpulgs8m60ylp4vufwsg55whlqgua6a93vp2y4gpzamhxue69uhhyetvv9ujuer9wfnkjemf9e3k7mgzyphydppzm7m554ecwq4gsgaek2qk32atse2l4t9ks57dpms4mmhfxjc476g). We are not here to build another cage, however gilded. We are here to build tools for freedom.

Which brings me to our logo. The ship. A vessel, charting unknown waters. This is the perfect metaphor for what we do. We are explorers of the vast, open, cryptographic sea that Bitcoin and Nostr have created. These are new frontiers, wild and untamed. To navigate them, you need a sturdy ship, a skilled crew, and a clear destination.

The act of shipping is the act of setting sail. It’s the moment of truth. The moment your creation leaves the safety of the harbor and faces the real world. It’s scary. It’s exhilarating. It’s the whole point.

### Sovereign Tools, Sovereign Individuals

The "sovereign" part of our name is, of course, a direct nod to the seminal book [*The Sovereign Individual*](https://bitcoin-resources.com/books/the-sovereign-individual). It speaks to the *why* behind the what. We are not just building for the sake of building. We are building for a purpose: to birth new freedom tech.

What is freedom tech? It’s technology that empowers the individual. It’s technology that pushes back against centralization, against control, against surveillance. It’s technology that gives people the tools to be sovereign in the digital realm.

A sovereign engineer is someone who can stand on their own two feet. They can build, deploy, and maintain their creations. They are not dependent on the gatekeepers of the old world. They are, in a sense, full-stack individuals.

This is what we aim to cultivate in the program. Not just technical skills, but a mindset. A spirit of independence, of self-reliance, of radical agency.

### Join Us

So, what’s in a name? For us, everything.

Sovereign Engineering is our mission, encapsulated in two words. We are here to build. We are here to ship. We are here to explore the frontiers of freedom tech.

We are not a lab. We are not an incubator. We are a fleet. And we are setting sail.

The sea is wide and open. The winds are picking up. The journey has just begun.

[Come sail with us.](https://sovereignengineering.io/#apply)

I would like to sail with you remotely.

Replying to Avatar Gigi

GN

That’s probably me

You are very hypothetical. With such mindset we should not use utxo because future soft-fork could change utxo and made older ones be unspendable.

Rust fixes 1st with ownership and 3rd with exhaustive conditions covering all possibilities. Unfortunately, the 2nd will stay problem while humans keep coding.

We just closed yesterday with 106473 USD for a #bitcoin . That is the highest-ever daily close and also the highest-ever weekly close. It seems to me we are at the ATH at the moment, and everybody is in profit.

This is easy, there are many good ones. Just few out of my mind:

- Have fun staying poor.

- Bitcoin fixes this.

- Not your keys, not your crypto.

- 1 BTC = 1 BTC.

- Hodl.

#CRYPTO ( consisting of memecoins, NFTs, shitcoins, altcoins, ETH, SOL, ...) != #BTC

Keep in mind that #bitcoin dominance has been rising for the last two years from 38.8% to 63.7%. The world is healing and aligning with the #signal. Forget the #noise.

#Bitcoin is the signal, everything else is #noise. Don't let them distract you!

New mini project is coming together. 40+ components ordered. Let’s see if this will end sucessfully. #bitaxe #bitcoin #asic #lotteryminer

The tweets on my feed are written by AI.

The blogposts on internet are written by AI.

The Images I see online are generated by AI.

The news are produced by AI.

My followers are AI bots.

Videos on youtube are generated by AI.

Influencers are AI.

Fuxx this #ai matrix.

Hey people, where are you?

There is no traction without friction