this message was from 2015

just for fun i wrote some code that encode and decodes messages in this format, which a non-computer-science person claimed to have received by aliens while they were sleeping

what's interesting about this code: it's not binary, its quaternary. its composed of 4 different symbols in a way that lets you encode 3 different messages simultaneously, its a kind of multiplexed code.

already that was kind of curious to me. if someone did make this up its pretty clever and I've never seen this type of steganography before:

■┃│□│□□┃■┃│■┃│□┃■│┃■┃│□│□┃│■┃□□│□│┃□┃┃│■□┃┃□□│□┃■│┃■┃│┃□■┃││□┃□■■■┃■□■□□■┃┃│□┃□■■││■┃■□■■┃┃│■■│■■┃□■■│■│□┃┃■□■□│■┃│┃■┃□□■□│■□■■■□┃┃┃■□┃┃■┃│□││┃│■┃┃□┃││┃■│┃■┃┃┃□■■│□■□■□■│┃│■┃■┃□│┃│■■□■■││■┃┃││■┃┃□│┃┃■■■┃□■□■□■┃┃□■┃■│□││■■■□┃■││┃■■┃■■││┃■┃□□□│┃■│□□□■┃││□□│┃■■┃■■□■□□││□┃│■■□││■■┃□┃□││■□□□┃■││■□┃□■□┃│■

another interesting thing about 4-symbol codes is that it can be encoded as DNA:

ATGCGCCTATGATGCTAGTATGCGCTGATCCGCGTCTTGACTTCCGCTAGTATGTCATGGCTCAAATACACCATTGCTCAAGGATACAATTGAAGAATCAAGAGCTTACACGATGTATCCACGACAAACTTTACTTATGCGGTGATTCTGGTAGTATTTCAAGCACACAGTGATATCGTGAACAAGGATTGGATTCGTTAAATCACACATTCATAGCGGAAACTAGGTAATAAGGTATCCCGTAGCCCATGGCCGTAATAACACCGGCTGAACGGAATCTCGGACCCTAGGACTCACTGA

DNA has been theorized as a very efficient way to store information at very small scales.

the multiplexed message decodes to:

> imminent thrEat soon upon earths lead

> royal EMERTHER warn

> eMbRace this vess

this is probably a hoax, but reverse engineering the encoding was pretty fun.

Nice! Which one? #bookstr

Who dis? Good ol’ fashioned common sense!

I saw a post yesterday that someone vibe coded their own bitcoin lighting wallet, and furthermore they even shared a link for others to use it, and I cannot think of a better example of why vibe coders should never be taken seriously. 😂

Do not do this

I side swiped a wall in a parking garage yesterday while driving wife's vehicle, ending my 27 year record of not hitting anything.

#GM and I’ve resolved to not drink any more coffee for the rest of the year!!

Got my first traffic ticket in China, the endless AI cameras are all knowing and all seeing, you can’t dodge them. Was fined 100 RMB (~$14) for crossing a white line from the straight turn lane into the right turn lane. The local government was kind enough to text me about it

#Shakespeare is now listed on NostrApps.com

I love that Claude Code is available on mobile so I can vibe code while taking a shit

*i slowly approach with a box of tooth picks*

At the moment, I don’t have plans to integrate an ecash wallet. I don’t think it’s particularly safe.

For example, I could release a DM app that secretly asks users to sign transfer events, and I could steal their funds with very little effort. In today’s DM apps, users already have to approve a lot of encryption/decryption operations just to make things work, so they’re basically forced to approve everything.

In your demo video, the feature that interested me the most was using AI to generate images directly inside the editor, it looks extremely useful.

People rejected google glass but they are ok with always on, all-collecting ai spyware on their faces?

What changed? Collective IQ loss?

Aren't you just asking for a basic REQ? This is the barebones of Nostr, NIP-01.

One critical thing with pay-to-post is who is getting the money.

Where do I find HP potion

Not being on X daily has been interesting.

I am much less informed about breaking news. I miss all the noise.

The most important stuff gets filtered over to me via personal conversations, nostr, podcasts, and my wife.

I am definitely not as informed as i used to be but it’s not really holding me back from what i can tell.

GM GM 🌞

Heading to record a podcast now. What should I focus on?

yes, eventually I'm going to add boid dynamics where it can take different shapes, as well as move toward things its referring to on screen.

Taking inventory, I have 5 Thinkpads - an x220, T420, T400, T41, and X31.

There might be also be a T60 within the coffers of my garage, but I dare not venture forth to confirm.

3m tsunami expected (red areas)

This is ridiculous.

The fees cost more than the amount I want to send out.

hey lemon, thanks for reaching out. I was using it on Android, Brave browser (not PWA). The error appeared to be something related to the app I generated, not a problem with pocketvibe itself. I asked it to do something in nextjs, then simply react, and both times the resulting page was an error page. I'll upload more details later.